Restriction mapping map displays the order and location of restriction sites within a region of DNA, and the distance twhenMarketing Research and Data Analysis genetically engineering organisms) DNA fragments of interest-DNA from one source can be restriction map is also a very useful type of physical map that can be used in linkage studies to locate the constructed for small pieces of DNA sucha other organisms. Restriction maps are useful expressed in kilobases) between all such sites. Restriction maps are cons plasmids, viral genetic elements, and cloned segments of DNA's from inserted into a vector containing the same restriction site(s). of genes of interest (e.g. those causing disease). We will soon use restriction sites in this manner in conjunction with pedigree analysis. Objectives 1. Understand how restriction endonucleases work. (Read in text before 2. Understand and implem 3. Understand size-dependent sepa 4. Construct a restriction map of ax174 for restriction enzymes Dral and Hpal lab) ent a restriction digest (using 2 enzymes-single and double digest ration of nucleic acids via agarose gel electrophoresis Restriction Enzymes (endonucleases) the bacteria from which they were originally isolated, are naturally occurring enzymes Endonucleases, named for to destroy foreign DNA. These enzymes cleave DNA at specific sites by breaking the phosphodiester backbone of both strands of the double helix. The host genome is protected from these enzymes ng ine and adenine residues of their own genomes. The sequences that the endonucleases recognize are called restriction sites. Restriction endonucleases cleave strands in one of two different ways-formi either blunt ends or sticky (cohesive) ends (see below). Restriction sites occur in DNA due to chance, not “purpose” y methylation of the cytosi What is the probability of a 4-base restriction site (e g. TaqI) occurring randomly in DNA) A 6-base site (e g. Eco RI)? Recognition sequence and cleavage site Bacterial source Restriction enzyme Eco RI Taq AATTC- Escherichia coli C GA- T– Thermus aquaticus Py C GCG Pu Bacillus sp 8sp143 1 T–Deinococcus radiophilus Dra l AAC- Hpo enzae TCAGGCACATCGACTAGATTAGCTAAAGTGCACT AGTCCGTGTAGCTGATCTAATCGATTTCACGTGACCACAAA GGTOTTT CTGACTGGCTCTGTA GACTGACCGAGACAT Procedure Followed (attach or paste Gel Electrophoresis Image (Labeled) Restriction Map Standard Curve (attach or paste) Appendix. How to construct a restriction map once the fragment sizes are known. Restriction maps are often endonucleases. DNA is c constructed by performing double digests in which the DNA is cleaved by two different cut completely by both enzymes singly (in separate reactions), and then a separate reaction is performed which includes both enzymes Steps in map construction (illustrated with a sample problem): The figures below are the result of digestion of a 10 kb tragment of DNA with the restriction enzymes Bam and Hit. The first two lanes show the results of single digestions, and the third lane shows fragments generated with double digestion. All digestions are complete. Numbers are given in kilobases. Draw a restriction map of this DNA Step 1. Sum the fragment lengths for each digest. If the total fragment lengths for each of the digests are not equal, then one or more bands represent multiple fragments of identical length. Bam 6+4 10 kb Hit-4.5+3.5+2 10 kb 3.1.05 4 4 5+1+1+0 s-9 → Therefore, must be two bands of 1 kb length. +Hit Bam Hit Double digest Step 2. Determine whether the DNA is a linear or circular molecule. If the number of single digest bands equals the number of double digest bands, then the molecule is circular, if the number of summed singles exceeds the number of doubles, then the molecule is linear. Here 5 5 (remember 4.5-4. Bam 3.5 0.5 Step 3. Place the restriction sites for the least-frequently cutting restriction enzyme on a restriction map. Occasionally there may be multiple maps possible at this point. Bam Step 4. Locate single digest bands that match up with double digest bands but have no corresponding digest band of the same length from the other enzyme. This locates fragments of one enzyme that do not contain a restriction site for the other enzyme. Hit Step 5. Find fragments in the double digest which add up to the size of single digest fragments. This determines where the two sites lie in relation to one another. This is trial and error Hit Step 6. Draw the complete map, giving distances (shown in kb) between all contiguous restriction sites.